Un ensayo in vitro indica que la proteína Spike que codifica el material genético de las «vacunas» CoVID, destruye la inmunidad natural que nos protege.


Además de los efectos adversos, destruye nuestra inmunidad natural. No hay ningún beneficio al inyectarse ese veneno.

Se cita textualmente. «Aquí, mediante el uso de una línea celular in vitro, informamos que la proteína pico SARS-CoV-2 inhibe significativamente la reparación del daño del ADN, que es necesaria para la recombinación efectiva de V (D) J en la inmunidad adaptativa. Mecánicamente, Descubrimos que la proteína de pico se localiza en el núcleo e inhibe la reparación del daño del ADN al impedir el reclutamiento de las proteínas clave BRCA1 y 53BP1 de reparación del ADN en el sitio del daño. Nuestros hallazgos revelan un mecanismo molecular potencial por el cual la proteína de pico podría impedir la inmunidad adaptativa y subrayar los posibles efectos secundarios de las vacunas de larga duración basadas en picos».

Hui Jiang 1,2, * y Ya-Fang Mei 2,

Descargar PDF

*1Departamento de Biociencias Moleculares, Instituto Wenner-Gren, Universidad de Estocolmo, SE-10691 Estocolmo, Suecia2Departamento de Microbiología Clínica, Virología, Universidad de Umeå, SE-90185 Umeå, Suecia*Autores a los que debe dirigirse la correspondencia. Editor académico: Oliver SchildgenVirus 2021 , 13 (10), 2056; https://doi.org/10.3390/v13102056Recibido: 20 de agosto de 2021 / Revisado: 8 de septiembre de 2021 / Aceptado: 8 de octubre de 2021 / Publicado: 13 de octubre de 2021(Este artículo pertenece a la edición especial de Interacciones entre células huésped del SARS-CoV-2 )

Abstracto

El síndrome respiratorio agudo severo coronavirus 2 (SARS-CoV-2) ha provocado la pandemia de la enfermedad por coronavirus 2019 (COVID-19), que ha afectado gravemente a la salud pública y la economía mundial. La inmunidad adaptativa juega un papel crucial en la lucha contra la infección por SARS-CoV-2 e influye directamente en los resultados clínicos de los pacientes. Los estudios clínicos han indicado que los pacientes con COVID-19 grave presentan respuestas inmunitarias adaptativas retardadas y débiles; sin embargo, el mecanismo por el cual el SARS-CoV-2 impide la inmunidad adaptativa sigue sin estar claro. Aquí, mediante el uso de una línea celular in vitro, informamos que la proteína pico SARS-CoV-2 inhibe significativamente la reparación del daño del ADN, que es necesaria para la recombinación efectiva de V (D) J en la inmunidad adaptativa. Mecánicamente, Descubrimos que la proteína de pico se localiza en el núcleo e inhibe la reparación del daño del ADN al impedir el reclutamiento de las proteínas clave BRCA1 y 53BP1 de reparación del ADN en el sitio del daño. Nuestros hallazgos revelan un mecanismo molecular potencial por el cual la proteína de pico podría impedir la inmunidad adaptativa y subrayar los posibles efectos secundarios de las vacunas de larga duración basadas en picos.Palabras llave : SARS – CoV – 2 ; pico ; Reparación de daños en el ADN ; Recombinación V (D) J ; vacuna

1. Introducción

El síndrome respiratorio agudo severo coronavirus 2 (SARS-CoV-2) es responsable de la pandemia actual de la enfermedad por coronavirus 2019 (COVID-19) que ha provocado más de 2,3 millones de muertes. El SARS-CoV-2 es un virus de ARN de sentido positivo único envuelto que consta de proteínas estructurales y no estructurales [ 1 ]. Después de la infección, estas proteínas virales secuestran y desregulan la maquinaria celular del huésped para replicar, ensamblar y diseminar los virus de la progenie [ 2 ]. Estudios clínicos recientes han demostrado que la infección por SARS-CoV-2 afecta extraordinariamente el número y la función de los linfocitos [ 3 , 4 , 5 , 6]. En comparación con los supervivientes leves y moderados, los pacientes con COVID-19 grave manifiestan un número significativamente menor de linfocitos T totales, linfocitos T auxiliares y linfocitos T supresores [ 3 , 4 ]. Además, COVID-19 retrasa los niveles de IgG e IgM después de la aparición de los síntomas [ 5 , 6 ]. En conjunto, estas observaciones clínicas sugieren que el SARS-CoV-2 afecta el sistema inmunológico adaptativo. Sin embargo, el mecanismo por el cual el SARS-CoV-2 suprime la inmunidad adaptativa sigue sin estar claro.Como dos sistemas críticos de vigilancia del huésped, los sistemas inmunológico y de reparación del ADN son los sistemas primarios de los que dependen los organismos superiores para defenderse contra diversas amenazas y la homeostasis tisular. La evidencia emergente indica que estos dos sistemas son interdependientes, especialmente durante el desarrollo y la maduración de los linfocitos [ 7 ]. Como una de las principales vías de reparación de rotura de ADN de doble hebra (DSB), la reparación de unión de extremos no homólogos (NHEJ) desempeña un papel fundamental en la recombinación V (D) J mediada por la endonucleasa génica activadora de recombinación específica de linfocitos (RAG), lo que da como resultado un repertorio muy diverso de anticuerpos en las células B y receptores de células T (TCR) en las células T [ 8]. Por ejemplo, la pérdida de función de proteínas clave de reparación del ADN como ATM, DNA-PKcs, 53BP1, et al., Conduce a defectos en la reparación de NHEJ que inhiben la producción de células B y T funcionales, lo que conduce a inmunodeficiencia [ 7 , 9 , 10 , 11 ]. Por el contrario, la infección viral suele inducir daño al ADN a través de diferentes mecanismos, como la inducción de la producción de especies reactivas de oxígeno (ROS) y el estrés de replicación de la célula huésped [ 12 , 13 , 14]. Si el daño del ADN no se puede reparar adecuadamente, contribuirá a la amplificación de la patología inducida por infección viral. Por lo tanto, nuestro objetivo fue investigar si las proteínas SARS-CoV-2 secuestran el sistema de reparación del daño del ADN, lo que afecta la inmunidad adaptativa in vitro.

2. Materiales y métodos

2.1. Anticuerpos y reactivos

DAPI (Cat # MBD0015), doxorrubicina (Cat # D1515), H 2 O 2 (Cat # H1009), y los anticuerpos β-tubulina (Cat # T4026) se adquirieron de Sigma-Aldrich. Anticuerpos contra la etiqueta His (Cat # 12698), H2A (Cat # 12349), H2A.X (Cat # 7631), γ – H2A.X (Cat # 2577), Ku80 (Cat # 2753) y Rad51 (Cat # 8875) ) se adquirieron de Cell Signaling Technology (Danvers, MA, EE. UU.). Los anticuerpos 53BP1 (Cat # NB100-304) y RNF168 (Cat # H00165918 – M01) se obtuvieron de Novus Biologicals (Novus Biologicals, Littleton, CO, EE. UU.). Los anticuerpos Lamin B (Cat # sc – 374015), ATM (Cat # sc – 135663), DNA – PK (Cat # sc – 5282) y BRCA1 (Cat # sc – 28383) se compraron en Santa Cruz Biotechnology (Santa Cruz, CA, EE. UU.). El anticuerpo XRCC4 (Cat # PA5–82264) se adquirió de Thermo Fisher Scientific (Waltham, MA, EE. UU.).

2.2. Plásmidos

pHPRT-DRGFP y pCBASceI fueron amablemente regalados por Maria Jasin (plásmidos Addgene # 26476 y # 26477) [ 15 ]. pimEJ5GFP fue un regalo de Jeremy Stark (plásmido Addgene nº 44026) [ 16]. Las proteínas NSP1, NSP9, NSP13, NSP14, NSP16, espiga y nucleocápside se sintetizaron primero con optimización de codones y luego se clonaron en un vector de expresión de mamíferos pUC57 con una etiqueta C-terminal 6xHis. Se sintetizó una secuencia complementaria invertida RSS-GFP de 12 espaciadores: se sintetizó una RSS de 23 espaciadores para el vector informador V (D) J. Luego, la secuencia se clonó en el vector pBabe-IRES-mRFP para generar el vector informador pBabe-12RSS-GFPi-23RSS-IRES-mRFP. Secuencia RSS de 12 espaciadores: 5′ – CACAGTGCTACAGACTGGAACAAAAACC – 3 ′. 23 – secuencia RSS espaciadora: 5′ – CACAGTGGTAGTACTCCACTGTCTGGCTGTACAAAAACC – 3 ′. Las construcciones de expresión de RAG1 y RAG2 fueron generosamente regaladas por Martin Gellert (plásmido Addgene nº 13328 y nº 13329) [ 17 ].

2.3. Células y cultivo celular

Las células HEK293T y HEK293 obtenidas de la American Type Culture Collection (ATCC) se cultivaron bajo 5% de CO 2 a 37 ° C en medio Eagle modificado por Dulbecco (DMEM, alto contenido de glucosa, GlutaMAX) (Life Technologies, Carlsbad, CA, EE. UU.) Que contenía 10 % ( v / v ) de suero de ternero fetal (FCS, Gibco), penicilina al 1% ( v / v ) (100 UI / ml) y estreptomicina (100 μg / ml). Las células indicadoras HEK293T – DR – GFP y HEK293T – EJ5 – GFP se generaron como se describió anteriormente y se cultivaron bajo 5% de CO 2 a 37 ° C en el medio de cultivo mencionado anteriormente.

2.4. Ensayos de reportero de HR y NHEJ

La reparación de HR y NHEJ en células HEK293T se midieron como se describió anteriormente utilizando células estables DR-GFP y EJ5-GFP. En resumen, se sembraron 0,5 × 10 6 células informadoras estables HEK293T en placas de 6 pocillos y se transfectaron con 2 μg de plásmido de expresión I-SceI (pCBASceI) junto con plásmidos de expresión de proteínas del SARS-CoV-2. Cuarenta y ocho horas después de la transfección y el tratamiento con aspirina, las células se recolectaron y analizaron mediante análisis de citometría de flujo para determinar la expresión de GFP. Las medias se obtuvieron de tres experimentos independientes.

2.5. Fraccionamiento celular e inmunotransferencia

Para el ensayo de fracción celular, se utilizó el kit de fraccionamiento de proteínas subcelulares (Thermo Fisher) de acuerdo con las instrucciones del fabricante. Los lisados ​​de proteínas se cuantificaron utilizando el reactivo BCA (Thermo Fisher Scientific, Rockford, IL, EE. UU.). Las proteínas se resolvieron mediante electroforesis en gel de poliacrilamida y dodecilsulfato de sodio (SDS-PAGE), se transfirieron a membranas de nitrocelulosa (Amersham protran, 0,45 μm NC) y se inmunotransfirieron con anticuerpos primarios específicos seguidos de anticuerpos secundarios conjugados con HRP. Las bandas de proteína se detectaron usando SuperSignal West Pico o el kit de quimioluminiscencia Femto (Thermo Fisher Scientific).

2.6. Ensayo del cometa

Las células se trataron con diferentes reactivos de daño del ADN y luego se recolectaron en los puntos de tiempo indicados para el análisis. Celdas (1 × 10 5células / ml en solución salina tamponada con fosfato fría [PBS]) se resuspendieron en agarosa de bajo punto de fusión al 1% a 40 ° C en una proporción de 1: 3 vol / vol y se pipetearon en un CometSlide. A continuación, los portaobjetos se sumergieron en tampón de lisis preenfriado (NaCl 1,2 M, EDTA 100 mM, lauril sarcosinato de sodio al 0,1%, NaOH 0,26 M pH> 13) para la lisis durante la noche (18-20 h) a 4 ° C en la oscuridad. A continuación, se retiraron cuidadosamente los portaobjetos y se sumergieron en tampón de enjuague (NaOH 0,03 M y EDTA 2 mM, pH> 12) a temperatura ambiente (TA) durante 20 min en la oscuridad. Este paso de lavado se repitió dos veces. Los portaobjetos se transfirieron a una cámara de electroforesis horizontal que contenía tampón de enjuague y se separaron durante 25 min a un voltaje de 0,6 V / cm. Finalmente, los portaobjetos se lavaron con agua destilada, se tiñeron con yoduro de propidio 10 μg / mL y se analizaron por microscopía de fluorescencia.

2.7. Inmunofluorescencia

Las células se sembraron en cubreobjetos de vidrio en una placa de 12 pocillos y se transfectaron con el plásmido indicado durante 24 h. Luego, las células se trataron con o sin reactivos para dañar el ADN de acuerdo con la configuración experimental. Las células se fijaron en paraformaldehído (PFA) al 4% en PBS durante 20 min a TA y luego se permeabilizaron en Triton X-100 al 0,5% durante 10 min. Los portaobjetos se bloquearon en suero de cabra normal al 5% (NGS) y se incubaron con anticuerpos primarios diluidos en NGS al 1% durante la noche a 4ºC. A continuación, las muestras se incubaron con los anticuerpos secundarios indicados marcados con Alexa Fluor 488 o 555 (Invitrogen) diluido en NGS al 1% a TA durante 1 h. Posteriormente, se tiñeron con DAPI durante 15 min a TA. Los cubreobjetos se montaron usando el medio de montaje de fluorescencia Dako (Agilent) y se tomaron imágenes usando un microscopio confocal Nikon (Eclipse C1 Plus).

2.8. Análisis de recombinación V (D) J

Brevemente, el plásmido informador V (D) J contiene GFP invertido e IRES que conducen a RFP expresada continuamente. La RFP expresada continuamente es el control de transfección interno. Después de la co-transfección del gen1 / 2 de activación de la recombinación (RAG1 / 2) en las células, RAG1 / 2 cortará la RSS y la inducción mediada de DSB, si se produce la recombinación V (D) J, las GFP invertidas se ligan en orden positivo por NHEJ reparar. Entonces la célula expresará GFP funcional. Por lo tanto, las células doble positivas de GFP y RFP son la lectura del ensayo informador V (D) J [ 18]. Se transfectaron células 293T al 70% de confluencia con el indicador V (D) J GFP solo (fondo) o en combinación con las construcciones de expresión de RAG1 y RAG2, en una proporción de 1 µg del indicador V (D) J GFP: 0,5 µg RAG1: 0,5 µg de RAG2. Al día siguiente, se cambió el medio y, después de 48 h más, se recolectaron las células y se analizaron mediante citometría de flujo para determinar la expresión de GFP y RFP.

2.9. Análisis estadístico

Todos los experimentos se repitieron al menos tres veces utilizando muestras recogidas o preparadas de forma independiente. Los datos se analizaron mediante la prueba t de Student o ANOVA seguida de las pruebas de comparación múltiple de Tukey utilizando GraphPad 8.

3. Resultados

3.1. Efecto de las proteínas virales del SARS-CoV-2 de localización nuclear en la reparación del daño del ADN

La reparación del daño del ADN ocurre principalmente en el núcleo para asegurar la estabilidad del genoma. Aunque las proteínas del SARS-CoV-2 se sintetizan en el citosol [ 1 ], algunas proteínas virales también son detectables en el núcleo, incluidas Nsp1, Nsp5, Nsp9, Nsp13, Nsp14 y Nsp16 [ 19 ]. Investigamos si estas proteínas del SARS-CoV-2 de localización nuclear afectan el sistema de reparación del daño del ADN de la célula huésped. Para ello, construimos estos plásmidos de expresión de proteínas virales junto con plásmidos de expresión de picos y nucleoproteínas, que generalmente se consideran proteínas localizadas en el citosol. Confirmamos su expresión y localización mediante inmunotransferencia e inmunofluorescencia ( Figura 1 A y Figura S1A ). Nuestros resultados fueron consistentes con los de estudios anteriores [19 ]; De hecho, las proteínas Nsp1, Nsp5, Nsp9, Nsp13, Nsp14 y Nsp16 están localizadas en el núcleo, y las nucleoproteínas se localizan principalmente en el citosol. Sorprendentemente, encontramos la abundancia de la proteína pico en el núcleo ( Figura 1 A). La reparación de NHEJ y la reparación de la recombinación homóloga (HR) son dos vías principales de reparación del ADN que no solo controlan y aseguran continuamente la integridad del genoma, sino que también son vitales para las funciones adaptativas de las células inmunitarias [ 9 ]. Para evaluar si estas proteínas virales impiden la vía de reparación de DSB, examinamos la reparación de un DSB específico del sitio inducido por la endonucleasa I-SceI utilizando la proteína de fluorescencia verde de repetición directa (DR-GFP) y el total-NHEJ-GFP ( EJ5 – GFP) sistemas informadores para HR y NHEJ, respectivamente [ 15 , 16]. La sobreexpresión de Nsp1, Nsp5, Nsp13, Nsp14 y las proteínas de pico disminuyeron las eficiencias de reparación de HR y NHEJ ( Figura 1 B-E y Figura S2A, B ). Además, también encontramos que la sobreexpresión de Nsp1, Nsp5, Nsp13 y Nsp14 suprimió drásticamente la proliferación en comparación con otras proteínas estudiadas ( Figura S3A, B ). Por lo tanto, el efecto inhibidor de Nsp1, Nsp5, Nsp13 y Nsp14 sobre la reparación del daño del ADN puede deberse a efectos secundarios, como la detención del crecimiento y la muerte celular. Curiosamente, la proteína de pico sobreexpresada no afectó a la morfología o proliferación celular, pero suprimió significativamente la reparación de HR y NHEJ ( Figura 1 B-E, Figuras S2A, B y S3A, B ).

Virus 13 02056 g001 550

Figura 1. Efecto del síndrome respiratorio agudo severo coronavirus 2 (SARS-CoV-2) proteínas localizadas en el núcleo sobre la reparación del daño del ADN. ( A ) Distribución subcelular de las proteínas SARS-CoV-2. La inmunofluorescencia se realizó a las 24 h después de la transfección del plásmido que expresa las proteínas virales en células HEK293T. Barra de escala: 10 µm. ( B ) Esquema del reportero EJ5-GFP usado para monitorear la unión de extremos no homólogos (NHEJ). ( C ) Efecto del vector vacío (EV) y las proteínas SARS-CoV-2 sobre la reparación del ADN NHEJ. Los valores representan la media ± desviación estándar (SD) de tres experimentos independientes (véanse los gráficos FACS representativos en la Figura S2A ). ( D) Esquema del reportero DR-GFP usado para monitorear la recombinación homóloga (HR). ( E ) Efecto de las proteínas EV y SARS-CoV-2 sobre la reparación del ADN HR. Los valores representan la media ± SD de tres experimentos independientes (véanse los gráficos FACS representativos en la Figura S2B ). Los valores representan la media ± DE, n = 3. La significación estadística se determinó mediante el análisis de varianza unidireccional (ANOVA) en ( C , E ). ** p <0.01, *** p <0.001, **** p <0.0001.

3.2. La proteína espiga del SARS-CoV-2 inhibe la reparación del daño del ADN

Debido a que las proteínas de pico son críticas para mediar la entrada viral en las células huésped y son el foco de la mayoría de las estrategias de vacuna [ 20 , 21 ], investigamos más a fondo el papel de las proteínas de pico en la reparación del daño del ADN y su recombinación V (D) J asociada. Se cree que las proteínas de pico se sintetizan en el retículo endoplásmico rugoso (RE) [ 1 ]. Después de modificaciones postraduccionales como la glicosilación, las proteínas de pico se trafican a través del aparato de la membrana celular junto con otras proteínas virales para formar el virión maduro [ 1 ]. La proteína de pico contiene dos subunidades principales, S1 y S2, así como varios dominios funcionales o repeticiones [ 22 ] ( Figura 2A). En el estado nativo, las proteínas de pico existen como proteínas inactivas de longitud completa. Durante la infección viral, las proteasas de la célula huésped, como la furina proteasa, activan la proteína S escindiéndola en las subunidades S1 y S2, que es necesaria para la entrada del virus en la célula diana [ 23 ]. Además, exploramos diferentes subunidades de la proteína de pico para dilucidar las características funcionales necesarias para la inhibición de la reparación del ADN. Solo la proteína de pico de longitud completa inhibió fuertemente la reparación de NHEJ y HR ( Figura 2 B-E y Figura S4A, B). A continuación, buscamos determinar si la proteína de pico contribuye directamente a la inestabilidad genómica al inhibir la reparación de DSB. Monitoreamos los niveles de DSB usando ensayos de cometas. Después de diferentes tratamientos de daño del ADN, como la irradiación γ, el tratamiento con doxorrubicina y el tratamiento con H 2 O 2 , hay menos reparación en presencia de la proteína de pico ( Figura 2 F, G). Juntos, estos datos demuestran que la proteína de pico afecta directamente a la reparación del ADN en el núcleo.

Virus 13 02056 g002 550

Figura 2. La proteína de pico del coronavirus 2 del síndrome respiratorio agudo severo (SARS-CoV-2) inhibe la reparación del daño del ADN. ( A ) Esquema de la estructura primaria de la proteína pico del SARS-CoV-2. La subunidad S1 incluye un dominio N-terminal (DTN, 14 a 305 residuos) y un dominio de unión al receptor (RBD, 319 a 541 residuos). La subunidad S2 consta del péptido de fusión (FP, 788-806 residuos), secuencia de repetición heptapéptido 1 (HR1, 912-984 residuos), HR2 (1163-1213 residuos), dominio TM (TM, 1213-1237 residuos) y dominio del citoplasma (CT, 1237–1273 residuos). ( B , C ) Efecto de la expresión titulada de la proteína espiga sobre la reparación del ADN en células HEK-293T. ( D , E) Sólo la proteína espiga de longitud completa inhibe la reparación del ADN de unión de extremos no homólogos (NHEJ) y recombinación homóloga (HR). Los valores representan la media ± SD de tres experimentos independientes (véanse los gráficos FACS representativos en la Figura S4A, B ). ( F ) Las células HEK293T transfectadas con proteína de pico de longitud completa (S-FL) mostraron más daño en el ADN que las células transfectadas con vector vacío, S1 y S2 en diferentes condiciones de daño del ADN. Para doxorrubicina: 4 µg / mL, 2 h. Para irradiación γ: 10 Gy, 30 min. Para H 2 O 2 : 100 M, 1 h. Barra de escala: 50 µm. ( G ) Cuantificación correspondiente de los momentos de la cola del cometa de 20 campos diferentes con n> 200 cometas de tres experimentos independientes. La significación estadística se evaluó mediante un análisis de varianza de dos vías (ANOVA). NS (No significativo): * p > 0.05, ** p <0.01, *** p <0.001, **** p <0.0001.

3.3. Las proteínas de pico impiden el reclutamiento de proteínas de puntos de control de reparación de daños en el ADN

Para confirmar la existencia de proteína de pico en el núcleo, realizamos un análisis de fracción subcelular y encontramos que las proteínas de pico no solo están enriquecidas en la fracción de la membrana celular, sino que también son abundantes en la fracción nuclear, con expresión detectable incluso en la fracción unida a cromatina ( Figura 3 A). También observamos que la espiga tiene tres formas diferentes, la banda superior es una espiga altamente glicosilada, la del medio es una espiga de longitud completa y la inferior es una subunidad de espiga escindida. De acuerdo con el ensayo del cometa, también encontramos la regulación al alza del marcador de daño del ADN, γ – H2A.X, en células con sobreexpresión de proteína de pico en condiciones de daño del ADN ( Figura 3 B). Un estudio reciente sugirió que las proteínas de pico inducen estrés ER y degradación de proteínas asociada a ER [24 ]. Para excluir la posibilidad de que la proteína espiga inhiba la reparación del ADN al promover la degradación de la proteína reparadora del ADN, verificamos la expresión de algunas proteínas reparadoras de ADN esenciales en las vías de reparación NHEJ y HR y encontramos que estas proteínas reparadoras del ADN eran estables después de la sobreexpresión de la proteína espiga ( Figura 3).C). Para determinar cómo la proteína de pico inhibe las vías de reparación de NHEJ y HR, analizamos el reclutamiento de BRCA1 y 53BP1, que son las proteínas de punto de control clave para la reparación de HR y NHEJ, respectivamente. Encontramos que la proteína de pico inhibió marcadamente la formación de focos de BRCA1 y 53BP1 ( Figura 3 D – G). Juntos, estos datos muestran que la proteína espiga de longitud completa del SARS-CoV-2 inhibe la reparación del daño del ADN al obstaculizar el reclutamiento de la proteína de reparación del ADN.

Virus 13 02056 g003 550

Figura 3. La proteína de pico del coronavirus 2 del síndrome respiratorio agudo severo (SARS-CoV-2) impide el reclutamiento de proteínas del punto de control de reparación del daño del ADN. ( A ) La fracción de membrana (MF), la fracción citosólica (CF), la fracción nuclear soluble (SNF) y la fracción unida a la cromatina (CBF) de las células HEK293T transfectadas con la proteína del pico del SARS-CoV-2 se inmunotransfirieron para detectar el pico de la etiqueta de His y proteínas indicadas. ( B ) Izquierda: inmunotransferencias del marcador de daño del ADN γH2AX en el vector vacío (EV) y células HEK293T que expresan la proteína de pico después de una irradiación γ de 10 Gy. Derecha: cuantificación correspondiente de inmunotransferencias en la izquierda. Los valores representan la media ± DE ( n = 3). La significación estadística se determinó mediante la prueba t deStudent. **** p <0,0001. ( C ) Las inmunotransferencias de las proteínas relacionadas con la reparación del daño del ADN en las células HEK293T que expresan la proteína espiga. ( D ) Imágenes representativas de la formación de focos de 53BP1 en células HEK293 que expresan proteínas de pico y EV y expuestas a irradiación de γ de 10 Gy. Barra de escala: 10 µm. ( E ) Análisis cuantitativo de focos de 53BP1 por núcleo. Los valores representan la media ± SEM, n = 50. ( F ) Formación de focos de BRCA1 en células HEK293 que expresan proteínas de pico y vectores vacíos expuestas a irradiación γ de 10 Gy. Barra de escala: 10 µm. ( G ). Análisis cuantitativo de focos BRCA1 por núcleo. Los valores representan la media ± SEM, n = 50. La significancia estadística se determinó utilizando la t de Student-prueba. **** p<0,0001.

3.4. La proteína de pico altera la recombinación V (D) J in vitro

La reparación del daño del ADN, especialmente la reparación del NHEJ, es esencial para la recombinación V (D) J, que se encuentra en el núcleo de la inmunidad de las células B y T [ 9 ]. Hasta la fecha, se han desarrollado muchas vacunas aprobadas contra el SARS-CoV-2, como las vacunas de ARNm y las vacunas contra adenovirus-COVID-19, basadas en la proteína de pico de longitud completa [ 25 ]. Aunque es discutible si el SARS-CoV-2 infecta directamente a los precursores de linfocitos [ 26 , 27 ], algunos informes han demostrado que las células infectadas secretan exosomas que pueden transportar ARN o proteínas del SARS-CoV-2 a las células diana [ 28 , 29].]. Además, probamos si la proteína de pico reducía la recombinación de V (D) J mediada por NHEJ. Para ello, diseñamos un sistema informador de recombinación V (D) J in vitro de acuerdo con un estudio anterior [ 18 ] ( Figura S5 ). En comparación con el vector vacío, la sobreexpresión de la proteína de pico inhibió la recombinación de V (D) J mediada por RAG en este sistema indicador in vitro ( Figura 4 ).

Virus 13 02056 g004 550

Figura 4. La proteína de pico altera la recombinación de V (D) J in vitro. ( A ) Esquema del sistema informador V (D) J. ( B ) Los gráficos representativos de la citometría de flujo muestran que la proteína de pico del SARS-CoV-2 impide la recombinación de V (D) J in vitro. ( C ) Análisis cuantitativo de la recombinación relativa de V (D) J. Los valores representan la media ± DE, n = 3. La significación estadística se determinó mediante la prueba t de Student. **** p <0,0001.

4. Discusión

Nuestros hallazgos proporcionan evidencia de que la proteína de pico secuestra la maquinaria de reparación del daño del ADN y la maquinaria inmune adaptativa in vitro. Proponemos un mecanismo potencial por el cual las proteínas de pico pueden afectar la inmunidad adaptativa al inhibir la reparación del daño del ADN. Aunque no se ha publicado ninguna evidencia de que el SARS-CoV-2 pueda infectar timocitos o células linfoides de la médula ósea, nuestro ensayo informador in vitro V (D) J muestra que la proteína de pico impedía intensamente la recombinación V (D) J. De acuerdo con nuestros resultados, las observaciones clínicas también muestran que el riesgo de enfermedad grave o muerte con COVID-19 aumenta con la edad, especialmente los adultos mayores que tienen el mayor riesgo [ 22]. Esto puede deberse a que las proteínas de pico del SARS-CoV-2 pueden debilitar el sistema de reparación del ADN de las personas mayores y, en consecuencia, impedir la recombinación V (D) J y la inmunidad adaptativa. Por el contrario, nuestros datos proporcionan detalles valiosos sobre la participación de las subunidades de proteínas de pico en la reparación del daño del ADN, lo que indica que las vacunas basadas en picos de longitud completa pueden inhibir la recombinación de V (D) J en las células B, lo que también es consistente con un reciente estudio de que una vacuna basada en picos de longitud completa indujo títulos de anticuerpos más bajos en comparación con la vacuna basada en RBD [ 28]. Esto sugiere que el uso de epítopos antigénicos del pico como vacuna contra el SARS-CoV-2 podría ser más seguro y eficaz que el pico completo. En conjunto, identificamos uno de los mecanismos potencialmente importantes de la supresión del SARS-CoV-2 de la maquinaria inmunitaria adaptativa del huésped. Además, nuestros hallazgos también implican un efecto secundario potencial de la vacuna basada en picos de longitud completa. Este trabajo mejorará la comprensión de la patogénesis de COVID-19 y proporcionará nuevas estrategias para diseñar vacunas más eficientes y seguras.

Materiales complementarios

Los siguientes están disponibles en línea en https://www.mdpi.com/article/10.3390/v13102056/s1 , Figura S1: Expresión de proteínas del SARS-CoV-2 de localización nuclear en células humanas, Figura S2: Efecto del SARS nuclear- Proteínas CoV-2 en la vía de reparación del ADN NHEJ– y HR –, Figura S3: Nsp1, Nsp5, Nsp13, Nsp14 pero no inhiben la proliferación celular, Figura S4: Efecto de los mutantes espiga del SARS – CoV – 2 en el ADN NHEJ– y HR– vía de reparación, Figura S5: Ensayo de recombinación de V (D) J in vitro.

Contribuciones de autor

HJ concibió y diseñó el estudio. HJ e Y.-FM supervisaron el estudio, realizaron experimentos e interpretaron los datos. Redacción: preparación del borrador original, HJ; Redacción: revisión y edición, HJ e Y.-FM; Adquisición de fondos, Y.-FM Todos los autores han leído y aceptado la versión publicada del manuscrito.

Fondos

Este trabajo fue apoyado por la Universidad de Umeå, subvenciones de planificación de la facultad de medicina para COVID-19 (número de proyecto de investigación: 3453 16032 para YFM); la Lion’s Cancer Research Foundation de la Universidad de Umeå (subvenciones: LP 17–2153, AMP 19–982 y LP 20–2256 a YFM), y los fondos ALF de la unidad base para la investigación en unidades de salud académicas y unidades de salud universitarias en el norte de la salud región (ALF – Basenheten: 2019, 2020, 2021 a YFM).

Declaración de la Junta de Revisión Institucional

No aplica, debido a que este estudio no involucró a humanos ni animales.

Declaración de consentimiento informado

No aplica, debido a que este estudio no involucró a humanos.

Declaración de disponibilidad de datos

Los datos presentados en este estudio están disponibles en el texto principal y en los materiales complementarios .

Conflictos de interés

Los autores han declarado que no existen intereses en competencia. Los patrocinadores no tuvieron ningún papel en el diseño del estudio, la recopilación y el análisis de datos, la decisión de publicar o la preparación del manuscrito.

Referencias

  1. V’Kovski, P .; Kratzel, A .; Steiner, S .; Stalder, H .; Thiel, V. Biología y replicación del coronavirus: implicaciones para el SARS-CoV-2. Nat. Rev. Microbiol. 2021 , 19 , 155-170. [ Google Académico ] [ CrossRef ]
  2. Suryawanshi, RK; Koganti, R .; Agelidis, A .; Patil, CD; Shukla, D. Desregulación de la señalización celular por SARS-CoV-2. Trends Microbiol. 2021, 29 , 224–237. [ Google Académico ] [ CrossRef ]
  3. Qin, C .; Zhou, L .; Hu, Z .; Zhang, S .; Yang, S .; Tao, Y .; Xie, C .; Ma, K .; Shang, K .; Wang, W .; et al. Desregulación de la respuesta inmune en pacientes con coronavirus 2019 (COVID-19) en Wuhan, China. Clin. Infectar. Dis. 2020 , 71 , 762–768. [ Google Académico ] [ CrossRef ] [ PubMed ]
  4. Wang, F .; Nie, J .; Wang, H .; Zhao, Q .; Xiong, Y .; Deng, L .; Song, S .; Ma, Z .; Fregar.; Zhang, Y. Características de la alteración del subconjunto de linfocitos periféricos en la neumonía COVID-19. J. Infect. Dis. 2020 , 221 , 1762–1769. [ Google Académico ] [ CrossRef ] [ PubMed ]
  5. Zhang, G .; Nie, S .; Zhang, Z .; Zhang, Z. Cambio longitudinal del síndrome respiratorio agudo severo Coronavirus 2 Anticuerpos en pacientes con enfermedad por coronavirus 2019. J. Infect. Dis. 2020 , 222 , 183–188. [ Google Académico ] [ CrossRef ] [ PubMed ]
  6. Long, QX; Liu, BZ; Deng, HJ; Wu, GC; Deng, K .; Chen, YK; Liao, P .; Qiu, JF; Lin, Y .; Cai, XF; et al. Respuestas de anticuerpos al SARS-CoV-2 en pacientes con COVID-19. Nat. Medicina. 2020, 26 , 845–848. [ Google Académico ] [ CrossRef ]
  7. Bednarski, JJ; Sleckman, BP Lymphocyte development: Integración de la señalización de la respuesta al daño del ADN. Adv. Immunol. 2012 , 116 , 175–204. [ Google Académico ] [ PubMed]
  8. Malu, S .; Malshetty, V .; Francis, D .; Cortes, P. Papel de la unión de extremos no homólogos en la recombinación V (D) J. Immunol. Res. 2012 , 54 , 233–246. [ Google Académico ] [ CrossRef]
  9. Bednarski, JJ; Sleckman, BP En la intersección del daño del ADN y las respuestas inmunes. Nat. Rev. Immunol. 2019 , 19 , 231–242. [ Google Académico ] [ CrossRef ]
  10. Gapud, EJ; Sleckman, BP Funciones únicas y redundantes de ATM y DNA-PKcs durante la recombinación V (D) J. Celda. Ciclo 2011 , 10 , 1928-1935. [ Google Académico ] [ CrossRef ]
  11. Difilippantonio, S .; Gapud, E .; Wong, N .; Huang, CY; Mahowald, G .; Chen, HT; Kruhlak, MJ; Callen, E .; Livak, F .; Nussenzweig, MC; et al. 53BP1 facilita la unión de extremos de ADN de largo alcance durante la recombinación V (D) J. Nature 2008 , 456 , 529–533. [ Google Académico ] [ CrossRef ] [ PubMed ]
  12. Schwarz, KB Estrés oxidativo durante la infección viral: una revisión. Radic libre. Biol. Medicina. 1996 , 21 , 641–649. [ Google Académico ] [ CrossRef ]
  13. Xu, LH; Huang, M .; Fang, SG; Liu, DX La infección por coronavirus induce estrés de replicación del ADN en parte a través de la interacción de su proteína no estructural 13 con la subunidad p125 de la ADN polimerasa delta. J. Biol. Chem. 2011 , 286 , 39546–39559. [ Google Académico ] [ CrossRef ] [ PubMed ]
  14. Delgado-Roche, L .; Mesta, F. Estrés oxidativo como actor clave en la infección por coronavirus del síndrome respiratorio agudo severo (SARS-CoV). Arco. Medicina. Res. 2020 , 51 , 384–387. [ Google Académico ] [ CrossRef ] [ PubMed ]
  15. Pierce, AJ; Hu, P .; Han, M .; Ellis, N .; Jasin, la proteína de unión al extremo del ADN de M. Ku modula la reparación homóloga de roturas de doble hebra en células de mamíferos. Genes Dev. 2001 , 15 , 3237–3242. [ Google Académico ] [ CrossRef ]
  16. Bennardo, N .; Cheng, A .; Huang, N .; Stark, JM Alternative-NHEJ es una vía mecánicamente distinta de reparación de roturas cromosómicas en mamíferos. PLoS Genet. 2008 , 4 , e1000110. [ Google Académico ] [ CrossRef ]
  17. Sadofsky, MJ; Hesse, JE; McBlane, JF; Gellert, M. Expresión y actividad de recombinación V (D) J de proteínas RAG-1 mutadas. Ácidos nucleicos Res. 1993 , 21 , 5644–5650. [ Google Académico ] [ CrossRef ]
  18. Trancoso, I .; Bonnet, M .; Gardner, R .; Carneiro, J .; Barreto, V .; Demengeot, J .; Sarmento, L. Un nuevo ensayo informador cuantitativo fluorescente para objetivos de RAG y actividad de RAG. Parte delantera. Immunol. 2013 , 4 , 110. [ Google Académico ] [ CrossRef ]
  19. Zhang, J .; Cruz-cosme, R .; Zhuang, M.-W .; Liu, D .; Liu, Y .; Teng, S .; Wang, P.-H .; Tang, Q. Un estudio sistémico y molecular de la localización subcelular de las proteínas del SARS-CoV-2. Transducción de señal. Objetivo. El r. 2020 , 5 , 269. [ Google Académico ] [ CrossRef ]
  20. Shang, J .; Wan, Y .; Luo, C .; Ye, G .; Geng, Q .; Auerbach, A .; Li, F. Mecanismos de entrada celular del SARS-CoV-2. Proc. Natl. Acad. Sci. USA 2020 , 117 , 11727–11734. [ Google Académico ] [ CrossRef ]
  21. Du, L .; Oye.; Zhou, Y .; Liu, S .; Zheng, BJ; Jiang, S. La proteína de pico de SARS-CoV: un objetivo para el desarrollo terapéutico y de vacunas. Nat. Rev. Microbiol. 2009 , 7 , 226–236. [ Google Académico ] [ CrossRef ] [ PubMed ]
  22. Huang, Y .; Yang, C .; Xu, XF; Xu, W .; Liu, SW Propiedades estructurales y funcionales de la proteína de pico del SARS-CoV-2: potencial desarrollo de fármacos antivirus para COVID-19. Acta Pharmacol. Pecado. 2020 , 41 , 1141–1149. [ Google Académico ] [ CrossRef ] [ PubMed ]
  23. Hoffmann, M .; Kleine-Weber, H .; Schroeder, S .; Kruger, N .; Herrler, T .; Erichsen, S .; Schiergens, TS; Herrler, G .; Wu, NH; Nitsche, A .; et al. La entrada de células del SARS-CoV-2 depende de ACE2 y TMPRSS2 y está bloqueada por un inhibidor de proteasa clínicamente probado. Cell 2020 , 181 , 271–280.e8. [ Google Académico ] [ CrossRef ]
  24. Hsu, AC-Y .; Wang, G .; Reid, AT; Veerati, PC; Pathinayake, PS; Daly, K .; Mayall, JR; Hansbro, PM; Horvat, JC; Wang, F .; et al. La proteína Spike del SARS-CoV-2 promueve una respuesta hiperinflamatoria que puede mejorarse con el péptido antagonista de Spike y los inhibidores de la quinasa MAP y del estrés ER aprobados por la FDA in vitro. bioRxiv 2020 , 2020 , 317818. [ Google Scholar ]
  25. Polonia, GA; Ovsyannikova, IG; Kennedy, RB Inmunidad contra el SARS-CoV-2: revisión y aplicaciones para candidatos a vacunas de fase 3. Lancet 2020 , 396 , 1595–1606. [ Google Académico ] [ CrossRef ]
  26. Davanzo, GG; Codo, AC; Brunetti, NS; Boldrini, V .; Knittel, TL; Monterio, LB; de Moraes, D .; Ferrari, AJR; de Souza, GF; Muraro, SP; et al. El SARS-CoV-2 usa CD4 para infectar los linfocitos T colaboradores. medRxiv 2020 , 2020 , 20200329. [ Google Scholar ]
  27. Borsa, M .; Mazet, JM Atacando la defensa: el SARS-CoV-2 puede infectar células inmunes. Nat. Rev. Immunol. 2020 , 20 , 592. [ Google Académico ] [ CrossRef ]
  28. Barberis, E .; Vanella, VV; Falasca, M .; Caneapero, V .; Cappellano, G .; Raineri, D .; Ghirimoldi, M .; De Giorgis, V .; Puricelli, C .; Vaschetto, R .; et al. Los exosomas circulantes están fuertemente involucrados en la infección por SARS-CoV-2. Parte delantera. Mol. Biosci. 2021 , 8 , 632290. [ Google Académico ] [ CrossRef ]
  29. Sur, S .; Khatun, M .; Steele, R .; Isbell, TS; Ray, R .; Ray, RB Los exosomas de los pacientes con COVID-19 transportan tenascina-C y fibrinógeno-β para desencadenar señales inflamatorias en células de órganos distantes. bioRxiv 2021 , 2021 , 430369. [ Google Scholar ]

Fuente

esta web esta abierta al debate, no al insulto, estos seran borrados y sus autores baneados.

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Salir /  Cambiar )

Google photo

Estás comentando usando tu cuenta de Google. Salir /  Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Salir /  Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Salir /  Cambiar )

Conectando a %s